Filter Data





Abbreviations List


Study Descriptors Table
DataSet PubID TrialID VarName VarValue VarUnits
USDA Beltsville 1 1 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 2 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 3 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 4 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 5 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 6 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 7 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 8 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 9 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 10 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 11 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 12 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 13 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 14 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 15 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 16 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 17 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 23 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 24 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 25 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 27 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 29 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 31 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 33 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 1 35 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 4 2 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 4 3 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 0 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 0 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 1 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 2 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 3 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 4 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 4 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 5 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 5 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 6 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 7 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 8 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 9 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 10 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 10 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 11 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 3 12 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 1 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 6 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 2 7 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 5 1 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 5 2 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -
USDA Beltsville 5 3 Reference National Animal Nutrition Program (2014). Animal Performance Data, USDA Beltsville Agricultural Research Center. https://animalnutrition.org/. Accessed (Date) -

Dietary Ingredients Table
DataSet PubID TrialID TrtID UID RepUID VarName Varvalue VarUnits N SE SD
USDA Beltsville 1 0 23 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 0 42 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 1 42 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 1 43 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 1 44 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 1 12 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 1 23 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 1 24 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 2 22 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 2 14 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 2 42 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 3 42 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 3 43 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 3 44 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 3 13 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 3 23 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 4 12 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 4 14 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 4 23 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 4 22 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 4 42 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 5 42 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 5 43 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 5 44 - 1 Fd_DietInc 100 % - - -
USDA Beltsville 1 5 13 - 1 Fd_DietInc 100 % - - -

Dietary Nutrients Table
DataSet PubID TrialID TrtID SubjectID VarName Varvalue VarUnits N SE SD
USDA Beltsville 1 1 43 191 Dt_ADF 39.5 % DM - - -
USDA Beltsville 1 2 43 191 Dt_ADF 39.5 % DM - - -
USDA Beltsville 1 4 44 191 Dt_ADF 39.5 % DM - - -
USDA Beltsville 1 5 42 191 Dt_ADF 39.5 % DM - - -
USDA Beltsville 1 6 24 191 Dt_ADF 39.48 % DM - - -
USDA Beltsville 1 8 23 191 Dt_ADF 39.48 % DM - - -
USDA Beltsville 1 10 22 191 Dt_ADF 39.48 % DM - - -
USDA Beltsville 1 12 13 191 Dt_ADF 27.85 % DM - - -
USDA Beltsville 1 14 12 191 Dt_ADF 27.85 % DM - - -
USDA Beltsville 1 16 14 191 Dt_ADF 27.85 % DM - - -
USDA Beltsville 1 23 44 191 Dt_ADF 39.5 % DM - - -
USDA Beltsville 1 24 42 191 Dt_ADF 39.5 % DM - - -
USDA Beltsville 1 25 24 191 Dt_ADF 39.48 % DM - - -
USDA Beltsville 1 27 23 191 Dt_ADF 39.48 % DM - - -
USDA Beltsville 1 29 22 191 Dt_ADF 39.48 % DM - - -
USDA Beltsville 1 31 13 191 Dt_ADF 27.85 % DM - - -
USDA Beltsville 1 33 12 191 Dt_ADF 27.85 % DM - - -
USDA Beltsville 1 35 14 191 Dt_ADF 27.85 % DM - - -
USDA Beltsville 1 1 13 192 Dt_ADF 29.39 % DM - - -
USDA Beltsville 1 2 13 192 Dt_ADF 29.39 % DM - - -
USDA Beltsville 1 4 14 192 Dt_ADF 29.39 % DM - - -
USDA Beltsville 1 5 12 192 Dt_ADF 29.39 % DM - - -
USDA Beltsville 1 6 44 192 Dt_ADF 38.66 % DM - - -
USDA Beltsville 1 8 43 192 Dt_ADF 38.66 % DM - - -
USDA Beltsville 1 10 42 192 Dt_ADF 38.66 % DM - - -

Subjects Table
DataSet PubID TrialID TrtID SubjectID VarName Varvalue VarUnits N SE SD
USDA Beltsville 75 2 11 9215 Subj_Breed Holstein - - - -
USDA Beltsville 75 4 13 8866 Subj_Breed Holstein - - - -
USDA Beltsville 75 2 13 9085 Subj_Breed Holstein - - - -
USDA Beltsville 75 1 13 9098 Subj_Breed Holstein - - - -
USDA Beltsville 75 1 21 8462 Subj_Breed Holstein - - - -
USDA Beltsville 75 3 23 8866 Subj_Breed Holstein - - - -
USDA Beltsville 75 4 23 9085 Subj_Breed Holstein - - - -
USDA Beltsville 75 2 23 9098 Subj_Breed Holstein - - - -
USDA Beltsville 75 4 23 9215 Subj_Breed Holstein - - - -
USDA Beltsville 75 1 31 9085 Subj_Breed Holstein - - - -
USDA Beltsville 75 1 33 8866 Subj_Breed Holstein - - - -
USDA Beltsville 75 4 33 9098 Subj_Breed Holstein - - - -
USDA Beltsville 75 3 33 9215 Subj_Breed Holstein - - - -
USDA Beltsville 75 1 41 9215 Subj_Breed Holstein - - - -
USDA Beltsville 75 2 43 8866 Subj_Breed Holstein - - - -
USDA Beltsville 75 3 43 9085 Subj_Breed Holstein - - - -
USDA Beltsville 75 3 43 9098 Subj_Breed Holstein - - - -
USDA Beltsville 76 1 11 682 Subj_Breed Holstein - - - -
USDA Beltsville 76 2 11 9035 Subj_Breed Holstein - - - -
USDA Beltsville 76 3 11 9274 Subj_Breed Holstein - - - -
USDA Beltsville 76 3 11 9295 Subj_Breed Holstein - - - -
USDA Beltsville 76 3 11 9421 Subj_Breed Holstein - - - -
USDA Beltsville 76 4 11 9472 Subj_Breed Holstein - - - -
USDA Beltsville 76 1 11 9484 Subj_Breed Holstein - - - -
USDA Beltsville 76 2 11 9494 Subj_Breed Holstein - - - -

Performance Data Table
DataSet PubID TrialID TrtID SubjectID Site_Sample Day_Sample Time_Sample VarName VarValue VarUnits N SE SD VarType
USDA Beltsville 75 2 11 9215 Animal - - Abs_CP 2432.8 g/d - Nitrogen balance
USDA Beltsville 75 4 13 8866 Animal - - Abs_CP 3227.162 g/d - Nitrogen balance
USDA Beltsville 75 2 13 9085 Animal - - Abs_CP 2517.106 g/d - Nitrogen balance
USDA Beltsville 75 1 13 9098 Animal - - Abs_CP 2864.771 g/d - Nitrogen balance
USDA Beltsville 75 1 21 8462 Animal - - Abs_CP 2758.92 g/d - Nitrogen balance
USDA Beltsville 75 3 23 8866 Animal - - Abs_CP 2513.43 g/d - Nitrogen balance
USDA Beltsville 75 4 23 9085 Animal - - Abs_CP 3063.389 g/d - Nitrogen balance
USDA Beltsville 75 2 23 9098 Animal - - Abs_CP 2597.423 g/d - Nitrogen balance
USDA Beltsville 75 4 23 9215 Animal - - Abs_CP 2564.467 g/d - Nitrogen balance
USDA Beltsville 75 1 31 9085 Animal - - Abs_CP 1982.884 g/d - Nitrogen balance
USDA Beltsville 75 1 33 8866 Animal - - Abs_CP 2421.312 g/d - Nitrogen balance
USDA Beltsville 75 4 33 9098 Animal - - Abs_CP 2269.532 g/d - Nitrogen balance
USDA Beltsville 75 3 33 9215 Animal - - Abs_CP 2068.41 g/d - Nitrogen balance
USDA Beltsville 75 1 41 9215 Animal - - Abs_CP 1657.879 g/d - Nitrogen balance
USDA Beltsville 75 2 43 8866 Animal - - Abs_CP 2121.004 g/d - Nitrogen balance
USDA Beltsville 75 3 43 9085 Animal - - Abs_CP 2098.112 g/d - Nitrogen balance
USDA Beltsville 75 3 43 9098 Animal - - Abs_CP 1981.262 g/d - Nitrogen balance
USDA Beltsville 76 1 11 682 Animal - - Abs_CP 2246.369 g/d - Nitrogen balance
USDA Beltsville 76 2 11 9035 Animal - - Abs_CP 3159.295 g/d - Nitrogen balance
USDA Beltsville 76 3 11 9274 Animal - - Abs_CP 3045.435 g/d - Nitrogen balance
USDA Beltsville 76 3 11 9295 Animal - - Abs_CP 2609.343 g/d - Nitrogen balance
USDA Beltsville 76 3 11 9421 Animal - - Abs_CP 3005.7 g/d - Nitrogen balance
USDA Beltsville 76 4 11 9472 Animal - - Abs_CP 2536.533 g/d - Nitrogen balance
USDA Beltsville 76 1 11 9484 Animal - - Abs_CP 2220.556 g/d - Nitrogen balance
USDA Beltsville 76 2 11 9494 Animal - - Abs_CP 2570.52 g/d - Nitrogen balance

Infusion Data Table
DataSet PubID TrialID TrtID SubjectID InfusionLocation UID RepUID VarName VarValue VarUnits DayofPeriodStart DayofPeriodStop TimeofDayStart TimeofDayStop
Dairy Digestion (NRC 2001) 83 1 214 - Abomasum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 83 1 215 - Abomasum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 83 1 216 - Abomasum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 83 1 217 - Abomasum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 46 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 46100 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 46200 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 46300 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 47 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 47100 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 47200 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 47300 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 48 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 48100 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 48200 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 48300 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 49 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 49100 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 49200 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 123 1 49300 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 163 1 163 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 163 1 164 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 163 1 165 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 163 1 166 - Duodenum - 1 Inf_Acet 0 % - - - -
Dairy Digestion (NRC 2001) 83 1 214 - Abomasum - 1 Inf_ADF 0 g - - - -

In Vitro Data Table
DataSet PubID TrialID TrtID SubjectID PlateID WellID SubTrtID Site_sample Cell_Type Day_Sample_InVivo Day_Sample_InVitro Time_Sample VarName VarValue VarUnits N SE SD VarType
Microbial Data (2019) 541 1 8 34 - - - Rumen Protozoa InVit_BiomConcn 1.385 g/L - - - In Vitro Assays
Microbial Data (2019) 541 1 9 35 - - - Rumen Protozoa InVit_BiomConcn 5.273 g/L - - - In Vitro Assays
Microbial Data (2019) 542 1 10 46 - - - Rumen Fungi InVit_BiomConcn 0.009 g/L - - - In Vitro Assays
Microbial Data (2019) 542 1 10 47 - - - Rumen Fungi InVit_BiomConcn 0.02 g/L - - - In Vitro Assays
Microbial Data (2019) 542 1 10 48 - - - Rumen Fungi InVit_BiomConcn 0.022 g/L - - - In Vitro Assays
Microbial Data (2019) 542 1 10 49 - - - Rumen Fungi InVit_BiomConcn 0.006 g/L - - - In Vitro Assays
Microbial Data (2019) 542 1 10 50 - - - Rumen Fungi InVit_BiomConcn 0.006 g/L - - - In Vitro Assays
Microbial Data (2019) 538 1 3 21 - - - Rumen Bacteria InVit_CellConcn 10300000 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 3 22 - - - Rumen Bacteria InVit_CellConcn 6300000 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 3 23 - - - Rumen Bacteria InVit_CellConcn 7500000 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 4 24 - - - Rumen Bacteria InVit_CellConcn 30000 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 4 25 - - - Rumen Bacteria InVit_CellConcn 50000 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 4 26 - - - Rumen Bacteria InVit_CellConcn 40000 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 5 27 - - - Rumen Bacteria InVit_CellConcn 3e+05 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 5 28 - - - Rumen Bacteria InVit_CellConcn 9e+05 /mL - - - In Vitro Assays
Microbial Data (2019) 538 1 5 29 - - - Rumen Bacteria InVit_CellConcn 6e+05 /mL - - - In Vitro Assays
Microbial Data (2019) 539 1 6 30 - - - Rumen Bacteria InVit_CellConcn 0 /mL - - - In Vitro Assays
Microbial Data (2019) 540 1 7 31 - - - Rumen Bacteria InVit_CellConcn 64511690.866 /mL - - - In Vitro Assays
Microbial Data (2019) 540 1 7 32 - - - Rumen Bacteria InVit_CellConcn 0 /mL - - - In Vitro Assays
Microbial Data (2019) 540 1 7 33 - - - Rumen Bacteria InVit_CellConcn 23857417.187 /mL - - - In Vitro Assays
Microbial Data (2019) 542 1 10 36 - - - Rumen Bacteria InVit_CellConcn 2195143924.463 /mL - - - In Vitro Assays
Microbial Data (2019) 542 1 10 37 - - - Rumen Bacteria InVit_CellConcn 6902795383.81 /mL - - - In Vitro Assays
Microbial Data (2019) 542 1 10 38 - - - Rumen Bacteria InVit_CellConcn 7898797862.994 /mL - - - In Vitro Assays
Microbial Data (2019) 542 1 10 39 - - - Rumen Bacteria InVit_CellConcn 1489947617.261 /mL - - - In Vitro Assays
Microbial Data (2019) 542 1 10 40 - - - Rumen Bacteria InVit_CellConcn 1823794912.903 /mL - - - In Vitro Assays

Genome Transcripts Table
DataSet PubID TrialID TrtID SubjectID PlateID WellID SubTrtID Site_sample Cell_Type Day_Sample_InVivo Day_Sample_InVitro Time_Sample VarName VarValue VarUnits N SE SD VarType
Microbial Data (2019) 537 1 1 1 - - - Rumen Bacteria GPT_ForPrim TGGGTGTTAGAAATGGATTC - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 2 - - - Rumen Bacteria GPT_ForPrim GCTTCTGAAGAATCATTTGAAG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 3 - - - Rumen Bacteria GPT_ForPrim GGTATGGGATGAGCTTGC - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 4 - - - Rumen Bacteria GPT_ForPrim ACTGCAGCGCGAACTGTCAGA - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 5 - - - Rumen Bacteria GPT_ForPrim GGTTATCTTGAGTGAGTT - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 6 - - - Rumen Bacteria GPT_ForPrim GGACGATAATGACGGTACTT - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 7 - - - Rumen Bacteria GPT_ForPrim TGCTAATACCGAATGTTG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 8 - - - Rumen Bacteria GPT_ForPrim CTAATACCGCATAACAGCAT - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 9 - - - Rumen Bacteria GPT_ForPrim TGGGAAGCTACCTGATAGAG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 1 10 - - - Rumen Bacteria GPT_ForPrim AGTCGAGCGGTAAGATTG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 11 - - - Rumen Bacteria GPT_ForPrim TGGGTGTTAGAAATGGATTC - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 12 - - - Rumen Bacteria GPT_ForPrim GCTTCTGAAGAATCATTTGAAG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 13 - - - Rumen Bacteria GPT_ForPrim GGTATGGGATGAGCTTGC - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 14 - - - Rumen Bacteria GPT_ForPrim ACTGCAGCGCGAACTGTCAGA - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 15 - - - Rumen Bacteria GPT_ForPrim GGTTATCTTGAGTGAGTT - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 16 - - - Rumen Bacteria GPT_ForPrim GGACGATAATGACGGTACTT - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 17 - - - Rumen Bacteria GPT_ForPrim TGCTAATACCGAATGTTG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 18 - - - Rumen Bacteria GPT_ForPrim CTAATACCGCATAACAGCAT - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 19 - - - Rumen Bacteria GPT_ForPrim TGGGAAGCTACCTGATAGAG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 537 1 2 20 - - - Rumen Bacteria GPT_ForPrim AGTCGAGCGGTAAGATTG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 538 1 3 21 - - - Rumen Bacteria GPT_ForPrim GGTATGGGATGAGCTTGC - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 538 1 3 22 - - - Rumen Bacteria GPT_ForPrim CCCTAAAAGCAGTCTTAGTTCG - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 538 1 3 23 - - - Rumen Bacteria GPT_ForPrim TCTGGAAACGGATGGTA - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 538 1 4 24 - - - Rumen Bacteria GPT_ForPrim GGTATGGGATGAGCTTGC - - - - Genomic, proteomic, and transcript data
Microbial Data (2019) 538 1 4 25 - - - Rumen Bacteria GPT_ForPrim CCCTAAAAGCAGTCTTAGTTCG - - - - Genomic, proteomic, and transcript data